Skip to content

issues Search Results · language:Dune language:Python language:Java language:JavaScript language:Ruby language:Java

Filter by

58.2M results  (751 ms)

58.2M results

The CYBERNETIC_TAIL prototype s cybernetic_tailbone organ sets inorganic: True but never prosthetic_frame — it predates the #527/#539 chrome standard. And existing installs (Laszlo #2017) are stale, missing ...
bug

LLM Cost Anomaly Detected Key: prod-frontend Date: 2026-06-08 Actual: $12.92 Baseline: $4.68 Delta: +$8.24 Sigma: 28.0σ Severity: critical Agent Investigation The spend anomaly on `prod-frontend` on ...
critical
llm-cost-incident

For the moment, Glances expose an /all endpoint in the Restful API. This endpoint produce an huge JSON file. The goal of the proposal is to add a new endpoint: /all/msgpack That return the same JSON ...
new feature
restfulapi

Nome do Pesquisador tiago E-mail para Notificação tiagogabriel3542@gmail.com Primer Forward (5 - 3 ) GGTCAACAAATCATAAAGATATTGG Primer Reverse (5 - 3 ) TAAACTTCAGGGTGACCAAAAAATCA Região Alvo ...
running

DoesNotExist - Division matching query does not exist. - division id= WM50 - tournament id= 2252 Traceback File /home/ubuntu/django_project/dgf/management/base_dgf_command.py , line 34, in ...
Management Command Error

I ve checked my sent items and noticed that the welcome email is being sent daily to people. Not sure if it s related but when I initially spun up the container I didn t have email setup, but then someone ...

using System.Windows; namespace ChatClient { public partial class LoginWindow : Window { public string UserName { get; private set; } = ; public string RoomName { get; private set; } = ; public LoginWindow() ...

https://registry.nonebot.dev/plugin/nonebot-plugin-htmlrender:nonebot_plugin_htmlrender https://registry.nonebot.dev/plugin/nonebot-plugin-picmenu-next:nonebot_plugin_picmenu_next

♻️ 개선 대상 - domain/cart/entity/Cart.java - domain/cart/service/CartService.java - domain/cart/repository/CartRepository.java - domain/cartitem/entity/CartItem.java - domain/cartitem/repository/CartItemRepository.java ...
Issue origami icon

Learn how you can use GitHub Issues to plan and track your work.

Save views for sprints, backlogs, teams, or releases. Rank, sort, and filter issues to suit the occasion. The possibilities are endless.Learn more about GitHub Issues
ProTip! Restrict your search to the title by using the in:title qualifier.
Issue origami icon

Learn how you can use GitHub Issues to plan and track your work.

Save views for sprints, backlogs, teams, or releases. Rank, sort, and filter issues to suit the occasion. The possibilities are endless.Learn more about GitHub Issues
ProTip! Restrict your search to the title by using the in:title qualifier.