issues Search Results · language:Dune language:Python language:Java language:JavaScript language:Ruby language:Java
Filter by
58.2M results
The CYBERNETIC_TAIL prototype s cybernetic_tailbone organ sets inorganic: True but never prosthetic_frame — it predates
the #527/#539 chrome standard. And existing installs (Laszlo #2017) are stale, missing ...
bug
LLM Cost Anomaly Detected
Key: prod-frontend
Date: 2026-06-08
Actual: $12.92
Baseline: $4.68
Delta: +$8.24
Sigma: 28.0σ
Severity: critical
Agent Investigation
The spend anomaly on `prod-frontend` on ...
critical
llm-cost-incident
For the moment, Glances expose an /all endpoint in the Restful API. This endpoint produce an huge JSON file.
The goal of the proposal is to add a new endpoint: /all/msgpack
That return the same JSON ...
new feature
restfulapi
Nome do Pesquisador
tiago
E-mail para Notificação
tiagogabriel3542@gmail.com
Primer Forward (5 - 3 )
GGTCAACAAATCATAAAGATATTGG
Primer Reverse (5 - 3 )
TAAACTTCAGGGTGACCAAAAAATCA
Região Alvo ...
running
DoesNotExist
- Division matching query does not exist.
- division id= WM50
- tournament id= 2252
Traceback
File /home/ubuntu/django_project/dgf/management/base_dgf_command.py , line 34, in ...
Management Command Error
I ve checked my sent items and noticed that the welcome email is being sent daily to people.
Not sure if it s related but when I initially spun up the container I didn t have email setup, but then someone ...
using System.Windows;
namespace ChatClient { public partial class LoginWindow : Window { public string UserName { get; private set; } = ;
public string RoomName { get; private set; } = ;
public LoginWindow() ...
https://registry.nonebot.dev/plugin/nonebot-plugin-htmlrender:nonebot_plugin_htmlrender
https://registry.nonebot.dev/plugin/nonebot-plugin-picmenu-next:nonebot_plugin_picmenu_next
♻️ 개선 대상
- domain/cart/entity/Cart.java
- domain/cart/service/CartService.java
- domain/cart/repository/CartRepository.java
- domain/cartitem/entity/CartItem.java
- domain/cartitem/repository/CartItemRepository.java ...

Learn how you can use GitHub Issues to plan and track your work.
Save views for sprints, backlogs, teams, or releases. Rank, sort, and filter issues to suit the occasion. The possibilities are endless.Learn more about GitHub IssuesProTip! Restrict your search to the title by using the in:title qualifier.